Downregulation of hepcidin and haemojuvelin expression in the hepatocyte cell-line HepG2 induced by thalassaemic sera

Sistemas Operativos

10 pages
0 views

Please download to get full document.

View again

of 10
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Share
Description
β-Thalassaemia represents a group of diseases, in which ineffective erythropoiesis is accompanied by iron overload. In a mouse model of β-thalassaemia, we observed that the liver expressed relatively low levels of hepcidin, which is a key factor in
Transcript
  Downregulation of hepcidin and haemojuvelin expression inthe hepatocyte cell-line HepG2 induced by thalassaemic sera Thalassaemias are a heterogeneous group of inherited anae-mias resulting from reduced or absent synthesis of globinchains of haemoglobin (Gu & Zeng, 2002). Patients with b -thalassaemia major (TM) exhibit a reduction or a lack of synthesis of the  b -chain of haemoglobin (Weatherall  et al  ,1981), while the remaining excess  a -chains form unstableaggregates that result in premature destruction of the eryth-rocyte. This leads to severe anaemia, increased erythrocyteturnover and ineffective erythropoiesis (Pootrakul  et al  , 1988;Rund & Rachmilewitz, 2005). To treat the anaemia, patientsregularly undergo blood transfusions, which exacerbate theiriron overload caused by increased intestinal absorption. Ironaccumulation results in severe damage and fibrosis of vitalorgans, particularly of the heart, liver and endocrine organs(Olivieri & Brittenham, 1997).Hepcidin, first identified in the urine as an antimicrobialpeptide, is a key regulator of iron absorption. The peptide issecreted from the liver as a small, cysteine-rich chain of 20, 22or 25 amino acids, which is derived from an 84 amino acid-propeptide (Krause  et al  , 2000; Park   et al  , 2001). Hepcidininhibits duodenal iron absorption, iron release from thereticuloendothelial system, and iron transport across theplacenta (Ganz, 2003). The 25 amino acid form of hepcidinwas recently shown to post-translationally regulate iron-regulated transporter 1( SLC40A1 , also called ferroportin), aniron exporter present on the surface of absorptive enterocytes,macrophages, hepatocytes and placental cells. Hepcidin bindsferroportin, leading to its internalisation and degradation, andtherefore to decreased export of cellular iron to the plasma(Nemeth  et al  , 2004). A recent study showed that hepicidin Orly Weizer-Stern, 1 * KonstantinAdamsky, 1 * Ninette Amariglio, 1 CarinaLevin, 2 Ariel Koren, 2 William Breuer, 3 Eliezer Rachmilewitz, 4 Laura Breda, 5 Stefano Rivella, 5 Z. Ioav Cabantchik  3 andGideon Rechavi 1 1 Cancer Research Centre and Paediatric Haematology-Oncology, Safra Children’sHospital, Sheba Medical Centre and Sackler  Medical School, Tel Aviv University, Tel Aviv,Israel,  2 Paediatric Haematology Unit and Paediatrics Department B, ‘Ha’Emek’ Medical Centre, Afula, Israel,  3 Department of Biological Chemistry, Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel, 4 Department of Haematology, Edith Wolfson Medical Centre, Holon, Israel, and   5 Weill Medical College of Cornell University, Department of Pediatrics, Division of Haematology-Oncology,Children’s Blood Foundation Laboratories, New York, NY, USA Received 6 October 2005; accepted forpublication 18 June 2006Correspondence: Gideon Rechavi, Institute of Haematology, Chaim Sheba Medical Centre,52621 Tel-Hashomer, Israel.E-mail: gidi.rechavi@sheba.health.gov.il*Both authors contributed equally to this work. Summary b -Thalassaemia represents a group of diseases, in which ineffectiveerythropoiesis is accompanied by iron overload. In a mouse model of  b -thalassaemia, we observed that the liver expressed relatively low levelsof hepcidin, which is a key factor in the regulation of iron absorption by thegut and of iron recycling by the reticuloendothelial system. It washypothesised that, despite the overt iron overload, a putative plasma factorfound in  b -thalassaemia might suppress liver hepcidin expression. Sera from b -thalassaemia and haemochromatosis (C282Y mutation) patients werecompared with those of healthy individuals regarding their capacity to inducechanges the expression of key genes of iron metabolism in human HepG2hepatoma cells. Sera from  b -thalassaemia major patients induced a majordecrease in hepcidin ( HAMP  ) and lipocalin2 (oncogene 24p3) ( LCN2 )expression, as well as a moderate decrease in haemojuvelin ( HFE2 )expression, compared with sera from healthy individuals. A significantcorrelation was found between the degree of downregulation of   HAMP   and HFE2  induced by   b -thalassaemia major sera ( r   ¼  0 Æ 852,  P   < 0 Æ 0009).Decreased  HAMP   expression was also found in HepG2 cells treated withsera from  b -thalassaemia intermedia patients. In contrast, the majority of serafrom hereditary haemochromatosis patients induced an increase in  HAMP  expression, which correlated with transferrin (Tf) saturation ( r   ¼  0 Æ 765, P   < 0 Æ 0099). Our results suggest that, in  b -thalassaemia, serum factors mightoverride the potential effect of iron overload on  HAMP   expression, thereby providing an explanation for the failure to arrest excessive intestinal ironabsorption in these patients. Keywords :  hepcidin, haemojuvelin, thalassaemia, haemochromatosis, iron. research paper ª  2006 The AuthorsJournal Compilation  ª  2006 Blackwell Publishing Ltd,  British Journal of Haematology  ,  135 , 129–138 doi:10.1111/j.1365-2141.2006.06258.x  ( HAMP  ) mRNA expression is positively regulated by cellularhaemojuvelin and is suppressed by soluble haemojuvelin(Lin  et al  , 2005).The relationship between hepcidin and iron pathophysiol-ogy was explored by various experimental and clinicalobservations. Hepcidin-deficient mice develop severe ironoverload (Nicolas  et al  , 2001), while mice overexpressinghepcidin present with severe, iron-refractory anaemia (Nicolas et al  , 2002a). Mutations in the  HAMP   gene were identified infamilies with severe juvenile haemochromatosis (Roetto  et al  ,2003) while hepatic adenomas overexpressing hepcidin weredescribed in patients with severe iron refractory anaemia(Weinstein  et al  , 2002). Mice that were overloaded with ironshowed increased hepcidin expression in the liver (Pigeon et al  , 2001), while an iron deficient diet resulted in decreasedhepcidin liver expression and enhanced intestinal iron absorp-tion in rats (Frazer  et al  , 2002).Hepcidin expression increases dramatically during acuteinflammation, and is induced by lipopolysaccharide (LPS),interleukin (IL)-6 (Nemeth  et al  , 2003), IL-1  a  (Lee  et al  ,2005) and IL-1 b  (Inamura  et al  , 2005). Therefore, it is believedthat hepcidin is a key player in the mechanism of inflamma-tion-induced anaemia.Bleeding, haemolysis, hypoxia and erythropoietin injectionsstimulate erythropoiesis and decrease hepcidin expression inmice livers (Nicolas  et al  , 2002b). We have previously shownthat  HAMP   mRNA is decreased in the livers of Hbb th3/+ b -thalassaemia intermedia (TI) mice (Adamsky   et al  , 2004)and even more so in the Hbb th3/th3 TM mouse model (Weizer-Stern  et al  , 2006). Recently, urine hepcidin was found to besuppressed in patients with thalassaemia syndromes (Papa-nikolaou  et al  , 2005).The present study attempted to differentiate betweenprimary iron overload, and iron overload that accompaniesineffective erythropoiesis. An expression assay was designed,whereby sera collected from TM patients, TI patients, hered-itary haemochromatosis (HH) patients and healthy individualswere compared in terms of their ability to induce theexpression of   HAMP   and other iron metabolism-related genesin the HepG2 cell line. Unlike haemochromatotic sera, whichinduced  HAMP   expression, sera from TM and intermediapatients downregulated  HAMP   expression in the HepG2 cellline. These findings may explain the inappropriate ironabsorption of   b -thalassaemia patients despite their ironoverload, and suggest that hepcidin might be considered as anew potential treatment for iron overload in thalassaemia. Materials and methods Patients and blood collection The study was approved by the local ethical committee of ‘Ha’Emek’ Medical Centre, Afula, Israel, and by the ethicalcommittee of Tel-Aviv University, Tel-Aviv, Israel. Informedconsent was obtained from the patients or their legalguardians. Blood collected into vacutainer tubes was left toclot at room temperature for 15–30 min, centrifuged for10 min at 800  g   and the serum aliquoted and stored at  ) 20  Cuntil use. Samples were collected from (1) TM patients( n  ¼  11), who were treated with blood transfusions regularly every 3 weeks and deferoxamine daily, by overnight infusion.Blood samples were taken >3 h after cessation of the overnightinfusion, and immediately before receiving blood transfusion(3 weeks or more after the previous blood transfusion),representing maximal erythropoietic drive. A second bloodsample was collected from 5 of the TM patients, 5–6 d afterblood transfusion, when erythropoiesis was suppressed. (2) TIpatients ( n  ¼  10). The diagnosis of TI was made on the basisof starting transfusions after the age of 2 years and/orhaemoglobin levels of 7 g/dl or higher (Karimi  et al  , 2005).Four of the TI patients (HI1-4) were treated with bloodtransfusions every 3 weeks (from whom blood was collectedimmediately before transfusion) and six patients (HI5-10)were not transfused. None of the patients in this group weretreated with deferoxamine. (3) HH patients (C282Y  HFE  mutation;  n  ¼  12), treated by periodic phlebotomies every 12–14 weeks. Blood samples were taken immediately prior tophlebotomy. (4) Healthy individuals ( n  ¼  4), after verifyingthat haemoglobin, Tf, ferritin and serum iron levels werewithin the normal ranges. All the haematological and bio-chemical tests were carried out by standard hospital laboratory procedures. The haematological and biochemical parametersfor each group are detailed in Table I. Effect of human sera on cell culture The human hepatoma HepG2 cell-line was grown in RPMImedium supplemented with 10% heat-inactivated fetal calf serum (FCS), glutamine and combined antibiotics. For theexamination of serum effect, the cells were seeded in 6-wellplates. When 60% confluent, the cells were starved of FCS for24 h, after which the medium was changed to RPMI mediumcontaining 10% human serum. After an additional 48 h, thecells were harvested for RNA isolation and gene expressionanalysis. Isolation of total RNA, first-strand cDNA synthesis and real-time quantitative polymerase chain reaction Total RNA isolation was performed using TRIZOL Reagent(Invitrogen, San-Diego, CA, USA), according to the manufac-turer’s procedure. cDNA synthesis was carried out using250 ng random primers, 5  l g total RNA, 1  l l 10 mmol/ldNTP, 4  l l 5 ·  first-strand buffer, 2  l l 0 Æ 1 mol/l dithiothreitol(DTT), 1  l l ribonuclease inhibitor RNaseOUT (40 U/ l l) and1  l l (200 U) of Moloney Murine Leukemia Virus ReverseTranscriptase (Invitrogen), as per manufacturer’s recommen-dation.Primers were designed using the  primer express  pro-gramme (Perkin Elmer, Norwalk, CT, USA) and mRNA O. Weizer-Stern  et al  ª  2006 The Authors 130  Journal Compilation  ª  2006 Blackwell Publishing Ltd,  British Journal of Haematology  ,  135 , 129–138  sequences from the Genebank database (Table II). Quantifi-cation of cDNA targets was performed on ABI Prism 7900HTSequence Detection System (SDS) (Applied Biosystems, FosterCity, CA, USA), utilising  sds  2 Æ 1 Software. The transcripts weredetected using SYBR Green I according to the manufacturer’sinstructions. The expression of each gene in each samplewas measured in duplicate, and was normalised according to b -actin (  ACTB ) expression for internal control. Optimalreaction conditions for amplification of the target geneswere performed according to the manufacturer’s (AppliedBiosystems) recommendation. Data analysis Mean ± standard deviation was calculated, and comparisonsbetween groups were made by Student’s  t  -test. A value of  P   < 0 Æ 05 was accepted as statistically significant. The linearrelationship between continuous variables was assessed by determining Pearson correlation coefficients ( P  -value < 0 Æ 05was considered significant) using  graphpad prizm  software(San Diego, CA, USA). Results Hepcidin expression in HepG2 cells exposed to sera fromthalassaemia and haemochromatosis patients Cells from the human hepatoma cell line HepG2 were exposedto human sera collected from 11 TM patients, 10 TI patientsand 12 haemochromatosis (HH) patients ( HFE   C282Y muta-tion). After 48 h the cells were harvested and RNA wasextracted and analysed for expression of genes associated withiron metabolism by real-time quantitative (RQ) reversetranscription polymerase chain reaction (RT-PCR). Samplesfrom cells treated with sera of the three groups of patients weretested for  HAMP   expression, then normalised to  b -actinexpression. Normalised  HAMP   expression levels were com-pared with the average  HAMP   expression levels observed inHepG2 cells treated with sera from healthy individuals ( n  ¼  3;mRNA expression between normal sera was always notsignificant) in each independent experiment (Fig 1). All theresults are presented as fold change, relative to hepcidinexpression in cells treated with sera of healthy individuals,which was arbitrarily determined as 1. HAMP   expression in HepG2 cells exposed to sera from TMpatients was significantly lower than in those exposed to serafrom healthy individuals: The mean value was 6 Æ 8-fold lowerthan the value obtained from healthy individuals’ sera(Fig 1A).  HAMP   expression in HepG2 cells exposed to serafrom TI patients was also low, with a mean 1 Æ 9-fold lower thanthe value obtained from healthy individuals’ sera (Fig 1B). HAMP   values were significantly lower in the TM group than inthe TI group ( P   ¼  0 Æ 038).In contrast,  HAMP   expression in HepG2 cells exposed tosera from HH patients increased two- to sevenfold comparedwith healthy controls (Fig 1C). The effect of blood transfusion on hepcidin expression HepG2 cells were exposed to sera collected from five of the TMpatients, 5–6 d after receiving a blood transfusion. Patients’haemoglobin levels rose as a result of the blood transfusion, Table I.  Haematological and biochemical parameters of the patients.PhenotypeTM TI HHNumber ( n ) 11 10 12TransferrinMedian (g/l) 1 Æ 34 1 Æ 51 1 Æ 94Range (g/l) 1 Æ 1–1 Æ 69 1 Æ 07–1 Æ 85 1 Æ 6–2 Æ 75Serum iron ( l mol/l)Median 31 28 Æ 35 19 Æ 6Range 23 Æ 2–37 Æ 8 11 Æ 9–43 10 Æ 3–40Transferrin saturation (%)Median 102 91 39 Æ 5Range 87–107 29–101 18–84Ferritin ( l g/l)Median 2878 1558 Æ 5 88 Æ 9Range 499–5807 130–7818 16 Æ 5–835 Æ 9Haemoglobin (g/dl)Median 8 Æ 9 8 Æ 05 N/ARange 7 Æ 1–10 Æ 7 6 Æ 5–10 Æ 9 N/ATM,  b -thalassaemia major patients; TI,  b -thalassaemia intermediapatients; HH, hereditary haemochromatosis patients (Normal val-ues: Hb 13–18 g/dl for males, 12–16 g/dl for females; transferrin2 Æ 3–3 Æ 9 g/l; ferritin 20–400  l g/l for males; 10–200  l g/l for females;serum iron 9–27  l mol/l). Table II.  Sequences of primers, used for real-time quantitative PCR assay. Gene Forward primer Reverse primerHepcidin CCACAACAGACGGG ACAACTT CAGCAGCCGCAGCAGAANGAL CTTCAAGATCACCCTCTACGGG GATTGGGACAGGGAAGACGATHFE GCAGGGTTCAAGAGGAGCC GTCACTCACGTTCAGCTAAGACGTATFR1 TTTGGATCGGTTGGTGCC CAGGGACGAAAGGTATCCCTCTFR2 TGCGCATAATGCGGGTG TCGGCTGGCGACACGTAHJV GGAGCTTGGCCTCTACTGGA ATGGTGAGCTTCCGGGTG b -actin TGTGGCATCCACGAAACTACC CTCAGGAGGAGCAATGATCTTGAT Thalassaemic sera reduces  HAMP   and  HFE2  mRNA in HepG2 cells ª  2006 The AuthorsJournal Compilation  ª  2006 Blackwell Publishing Ltd,  British Journal of Haematology  ,  135 , 129–138  131  from an average of 8 Æ 66 g/dl to an average of 10 Æ 5 g/dl.  HAMP  mRNA expression in the cells treated with sera collected afterblood transfusion was significantly higher than its expressionafter exposure to sera collected before blood transfusion (meanvalue of 0 Æ 088 before transfusion, compared with a mean valueof 0 Æ 645 after transfusion,  P   ¼  0 Æ 007). However, there was nocorrelation between the changes in haemoglobin levels and thechanges in  HAMP   expression in the HepG2 cells.Among the TI patients,  HAMP   expression in HepG2 cellstreated with sera from the subgroup that receive regular bloodtransfusions was significantly higher than in cells treated withsera from the non-transfused subgroup ( P   ¼  0 Æ 025). The expression of other iron-related genes in HepG2 cellsexposed to sera from thalassaemia and haemochromatosis patients RNA from cells treated with sera from TM and HH patientswas further tested for the expression of the following genes:neutrophil gelatinase-associated lipocalin [lipocalin2 (onco-gene 24p3);  LCN2 , also termed  NGAL ],  HFE  , haemojuvelin( HFE2 , also termed  HJV  ), Tf receptor 1 ( TFR1 , also termed TFRC  ) and Tf receptor 2 ( TFR2 ) (Fig 2).  LCN2  expressionwas downregulated in HepG2 cells exposed to sera from TMpatients (3 Æ 5- to ninefold compared with control) (Fig 2A),as well as in HepG2 cells treated with sera from HH patients(two- to threefold compared with control) (Fig 2B).  HFE  expression in HepG2 cells exposed to sera from TM patientsexhibited an inconsistent pattern (Fig 2C).  HFE   expressionin HepG2 cells exposed to sera from HH patients wasmoderately downregulated (1 Æ 5- to twofold compared withnormal sera) (Fig 2D).  TFR1  did not change significantly inHepG2 cells exposed to sera from TM patients (Fig 2E),although it was moderately downregulated (1 Æ 5- to threefold)in HepG2 cells exposed to sera from HH patients (Fig 2F). TFR2  was moderately decreased in HepG2 cells exposed tosera from TM patients (Fig 2G), but it exhibited aninconsistent pattern in HepG2 cells treated with sera fromHH patients (Fig 2H).  HFE2  was slightly downregulated incells treated with sera from TM patients and did not changesignificantly in cells treated with sera from HH patients(Fig 2I and J, respectively). Correlation of haematological parameters and hepcidinexpression in response to patient sera The effect of sera from HH patients (serum Tf satura-tion < 80%) on gene expression in HepG2 cells showed asignificant correlation between  HAMP  expression and serum Tf saturation ( r   ¼  0 Æ 765,  P   < 0 Æ 0099) (Fig 3B). In contrast, no Fig 1.  serum from patients with  b -thalassaemia major, hereditary haemochromatosis and  b -thalassaemia intermedia on hepcidinexpression in human hepatoma cell line HepG2. cDNA was preparedfrom the total RNA extracted from the HepG2 cell line treated with10% serum from patients with  b -thalassaemia major (A),  b -thalas-saemia intermedia (B) and hereditary haemochromatosis (C). Geneexpression of hepcidin was measured using specific primers forquantifiable reverse transcription polymerase chain reaction. Barsrepresent the fold change in mRNA expression in each patient, com-pared with control mRNA levels in HepG2 treated with serum fromhealthy individuals (punctuate line on the graph). TM,  b -thalassaemiamajor; HH, hereditary haemochromatosis; TI,  b -thalassaemia inter-media. Fig 2.  Serum from patients with  b -thalassaemia major and hereditary haemochromatosis on the expression of iron metabolism-related genes inhuman hepatoma cell line HepG2. cDNA was prepared from the total RNA extracted from HepG2 cell line treated with 10% serum from patients with b -thalassaemia major (left column) and hereditary haemochromatosis (right column). Gene expression of five iron regulatory genes was measuredusing specific primers for quantifiable reverse transcription polymerase chain reaction:  LCN2  (A, B),  HFE   (C, D),  TFR1  (E, F),  TFR2  (G, H) and  HFE2 (I, J). Bars represent the fold change in mRNA expression in each patient, compared with control mRNA levels in HepG2 treated with serum fromhealthy individuals (punctuate line on the graph). TM,  b -thalassaemia major; HH, hereditary haemochromatosis. O. Weizer-Stern  et al  ª  2006 The Authors 132  Journal Compilation  ª  2006 Blackwell Publishing Ltd,  British Journal of Haematology  ,  135 , 129–138  Thalassaemic sera reduces  HAMP   and  HFE2  mRNA in HepG2 cells ª  2006 The AuthorsJournal Compilation  ª  2006 Blackwell Publishing Ltd,  British Journal of Haematology  ,  135 , 129–138  133
Advertisement
Related Documents
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks