Impact of Bt Corn on Rhizospheric and Soil Eubacterial Communities and on Beneficial Mycorrhizal Symbiosis in Experimental Microcosms

Informática

11 pages
2 views

Please download to get full document.

View again

of 11
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Share
Description
Impact of Bt Corn on Rhizospheric and Soil Eubacterial Communities and on Beneficial Mycorrhizal Symbiosis in Experimental Microcosms
Transcript
   A  PPLIED AND  E NVIRONMENTAL   M ICROBIOLOGY , Nov. 2005, p. 6719–6729 Vol. 71, No. 110099-2240/05/$08.00  0 doi:10.1128/AEM.71.11.6719–6729.2005Copyright © 2005, American Society for Microbiology. All Rights Reserved. Impact of Bt Corn on Rhizospheric and Soil Eubacterial Communitiesand on Beneficial Mycorrhizal Symbiosis in Experimental Microcosms M. Castaldini, 1  A. Turrini, 2 C. Sbrana, 3  A. Benedetti, 4 M. Marchionni, 4 S. Mocali, 4  A. Fabiani, 1 S. Landi, 1 F. Santomassimo, 1 B. Pietrangeli, 5 M. P. Nuti, 2,3 N. Miclaus, 1 and M. Giovannetti, 2,3 *  Istituto Sperimentale per lo Studio e la Difesa del Suolo, C. R. A., Piazza Massimo D’Azeglio 30, 50121 Florence, Italy 1  ; Dipartimento di Biologia della Piante Agrarie, Via del Borghetto 80, 56124 Pisa, Italy 2  ; Istituto di Biologia e Biotecnologia Agraria C. N. R., Sezione di Pisa, Via del Borghetto 80, 56124 Pisa, Italy 3  ; Istituto per la Nutrizione delle Piante, C. R. A., Via della Navicella 2/4, 00184 Rome, Italy 4  ; and Istituto Superiore per la Prevenzione e la Sicurezza del lavoro, Via Urbana 167, 00184 Rome, Italy 5 Received 14 April 2005/Accepted 27 June 2005  A polyphasic approach has been developed to gain knowledge of suitable key indicators for the evaluation of environmental impact of genetically modified Bt 11 and Bt 176 corn lines on soil ecosystems. We assessed theeffects of Bt corn (which constitutively expresses the insecticidal toxin from  Bacillus thuringiensis , encoded bythe truncated  Cry1Ab  gene) and non-Bt corn plants and their residues on rhizospheric and bulk soil eubacterialcommunities by means of denaturing gradient gel electrophoresis analyses of 16S rRNA genes, on the non-target mycorrhizal symbiont  Glomus mosseae , and on soil respiration. Microcosm experiments showed differ-ences in rhizospheric eubacterial communities associated with the three corn lines and a significantly lowerlevel of mycorrhizal colonization in Bt 176 corn roots. In greenhouse experiments, differences between Bt andnon-Bt corn plants were detected in rhizospheric eubacterial communities (both total and active), in culturablerhizospheric heterotrophic bacteria, and in mycorrhizal colonization. Plant residues of transgenic plants,plowed under at harvest and kept mixed with soil for up to 4 months, affected soil respiration, bacterialcommunities, and mycorrhizal establishment by indigenous endophytes. The multimodal approach utilized inour work may be applied in long-term field studies aimed at monitoring the real hazard of genetically modifiedcrops and their residues on nontarget soil microbial communities. Crop plants genetically modified (GM) for resistance topests represent a potential environmentally safe tool to de-crease the amount of chemical pesticides used in agriculture.One of the most widespread GM crops is Bt corn, whichconstitutively expresses the insecticidal toxin from  Bacillus thu- ringiensis , encoded by the truncated  Cry1Ab  gene. Bt corn isalso often modified to express the PAT gene from  Streptomyces spp., which confers tolerance to the herbicide glufosinate am-monium. Concerns have been raised about the environmentalrisks associated with the release of transgenic crops, includingthe potential impact on nontarget organisms, such as beneficialinsects, soil bacteria, and fungi, which play a fundamental rolein crop residue degradation and in biogeochemical cycles. Infact, many studies showed that soil microbes represent impor-tant key nontarget organisms able to highlight unforeseen col-lateral effects of transgenic plants on natural and agriculturalecosystems. For example, GM potato lines producing  Galan-thus nivalis  agglutinin and  Brassica napus  resistant to the her-bicide glyphosate modified the composition and diversity of soil and rhizospheric microbial communities (22, 63). Other works reported different effects of GM plants on soil microor-ganisms, mainly at the rhizosphere level, where root exudatesdirectly affect the composition of microbial soil communities,in terms of both structure and function (5, 21, 37, 38, 50, 60, 61,64, 66, 80).Laboratory and field studies have demonstrated that  B. thu- ringiensis  toxin is released in soil through three main pathways:(i) root exudates (55, 58, 59), (ii) plant residues plowed into thesoil after crop harvest (29, 81), and (iii) pollen falling down(35). In soil,  B. thuringiensis  toxin does not change its confor-mation (34) and remains active, protected from microbial deg-radation by absorption to clays or linkage to humic acids (6, 8,31). Moreover,  B. thuringiensis  toxin released through cornroot exudates retains its activity for 180 to 234 days in bothlaboratory and soil experiments (56, 67, 71), thus representinga potential risk for nontarget organisms and microorganisms(34, 73, 79, 82). For example, some authors reported a reduc-tion in the growth of bacteria occurring on feces of the crus-tacean  Porcellio scaber   fed with GM corn (13). Other studiesshowed no deleterious effects on soil microbial communities by  B. thuringiensis  toxin released into soil through root exudatesand by residues of Bt corn on culturable bacteria and sapro-phytic fungi, both in vitro and in vivo (32, 56, 72). An unex-pected effect—a higher lignin content compared to the non-transgenic isolines, which could affect microbial saprophyticcommunities—has been shown in some Bt transformants of canola, potato, maize, tobacco, and cotton (68).The results available on the impact of GM plants on naturaland agricultural ecosystems show that specific effects of singletransformation events should be tested on a case-by-case basis,using different target and nontarget organisms and multimodalexperimental approaches and taking into account biochemical,physiological, and molecular parameters.We carried out a 2-year polyphasic experiment with the aimof gaining knowledge on suitable key indicators to be used for * Corresponding author. Mailing address: Dipartimento di Biologiadella Piante Agrarie, Universita` di Pisa, Via del Borghetto 80, 56124Pisa, Italy. Phone: 39 050 9719324. Fax: 39 050 571562. E-mail:mgiova@agr.unipi.it.6719  the evaluation of environmental impact of genetically modifiedBt corn on soil ecosystems. The experiments were aimed atassessing the effects of two Bt corn lines (Bt 11 and Bt 176) on(i) rhizospheric and bulk soil eubacterial communities, bymeans of denaturing gradient gel electrophoresis (DGGE)analysis of 16S rRNA genes, a molecular fingerprinting tech-nique widely used to study the modification induced by differ-ent factors on soil microbes (4, 14, 20, 27, 39, 40, 42, 46, 47, 54,65, 80); (ii) the arbuscular mycorrhizal (AM) fungus  G. mos- seae , a nontarget microorganism, which establishes mutualisticsymbioses with the roots of most plant species; and (iii) soilrespiration.To this aim, we evaluated the effects of root exudates oneubacterial communities by using biochemical and molecularparameters and on different stages of the  G. mosseae  life cycle.Moreover, we investigated the effects of plant residues on totaland active eubacterial communities on  G. mosseae  and indig-enous AM fungus symbionts. MATERIALS AND METHODSExperimental design.  Bt corn plants (transformation events Bt 11 and Bt 176)genetically modified to express the  Cry1Ab  gene from  B. thuringiensis  and thenontransgenic corn line NK4640—the parental line of Bt 11, hereafter desig-nated by Wt—were used to test their effects on the composition and activity of soil and rhizospheric bacterial communities and on the AM fungal species  G. mosseae  (Nicolson and Gerdemann) Gerdemann and Trappe (IMA 1).In the first year, research was carried out at the microcosm level by using cornplants grown in an experimental model system (73) and at the greenhouse levelby growing corn plants in pots filled with nonsterile agricultural soil.In the second year, the experiments were carried out at greenhouse level bygrowing corn plants in pots filled with nonsterile agricultural soil where residues were plowed under at harvest. (i) Microcosm experiments.  Sporocarps of the AM fungal species  G. mosseae ,maintained in the pot culture collection of the Department of Crop Plant Biol-ogy, University of Pisa, Pisa, Italy, were extracted from pot culture soil by wetsieving and decanting down to a mesh size of 100   m (17). Fungal materialretained on sieves was flushed into petri dishes, manually collected with forcepsunder a dissecting microscope (Wild; Leica, Milano, Italy), and placed on 47-mm-diameter cellulose ester Millipore membranes (0.45-  m-diameter pores).Each membrane, inoculated with 10 sporocarps, was covered by another mem-brane and the sandwich obtained was incubated in moistened sterile acid-washedquartz grit (2- to 5-mm diameter) in the dark for 15 days at 25°C. After sporocarpgermination, the root system of both Bt and Wt corn plants was split in threeparts, each sandwiched within the Millipore membranes bearing germinatedsporocarps. Plants with sandwiched root systems were placed into 10-cm-diam-eter pots; buried with sterile, acid-washed quartz grit; and maintained undercontrolled conditions (18 to 24°C; 16- to 8-h photoperiod of irradiance at 100  Em  2 s  1 ; 60% relative humidity). Ten replicates were set up for each trial. Tworoot sandwiches from each plant were harvested after 8 and 35 days, respectively,for the bioassay of   G. mosseae , the third sandwich was harvested after 35 days,and the roots were maintained at   20°C until utilized for bacterial communitystudies (five replicates). (ii) Greenhouse experiments.  After 35 days’ growth in the microcosm, theplants were transferred into 40-cm-diameter pots filled with agricultural soilcollected from arable fields of the Centro Interdipartimentale di Ricerche Agro- Ambientali “Enrico Avanzi”, S. Piero a Grado, Pisa, Italy, with the followingcomposition: sand (65%), silt (22.8%), clay (12.2%), organic matter (1.7%), pH7.5. Corn plants were cultivated and maintained in a greenhouse for 10 weeks.In the second year, plants were grown in pots for 12 weeks and then plowedunder; leaves and stems of Bt 176, Bt 11, and Wt plants were cut into  2- to 3-cmpieces and mixed with the soil srcinating from the same pot where they weregrown. The biomass of plant residues plowed per pot, calculated using the meanof three corn plants grown in the same experimental conditions, was 8.3  0.7 g(dry weight). Bioassay of   G. mosseae . (i) First year; microcosm level.  The sandwiches usedfor the bioassay of   G. mosseae  were carefully opened, and plant roots werecleared with 10% KOH, stained with 0.05% trypan blue in lactic acid, andassessed for mycorrhizal infection. Infected roots from the first harvest wereselected under the dissecting microscope, mounted on microscope slides, andobserved under a Reichert-Jung Polyvar light microscope to determine totalnumber of fungal appressoria developing into functional infection units (i.e.,those developing arbuscules). Roots from the second harvest were assessed forthe percentage of infected root length, calculated by using the grid line intersectmethod (19). Percentage data were analyzed by analysis of variance (ANOVA)after arcsin square root transformation. (ii) First year; greenhouse level.  After 8 and 10 weeks’ growth in a greenhouse,plant root systems were sampled and the percentage of mycorrhizal infection wascalculated as described above. All data were submitted to one-way ANOVA. (iii) Second year; greenhouse level.  Soil samples containing plant residues were collected at time zero (July) and 2 months (September) and 4 months(November) after being plowed under; they were utilized to carry out the bio-assay on the AM fungus  G. mosseae . To test the effects of Bt plant residues onspore germination and hyphal growth of   G. mosseae , 15 sporocarps were placedon membranes in a sandwich system without plant roots. Sandwiches were placedonto petri dishes, covered with sampled soil mixed (1:1) with Terra Green 18/40(Oil Dri, Vernon Hills, Illinois), and maintained in the dark at 18 to 24°C at 60%RH. After 21 days, membranes were opened and stained with 0.05% trypan bluein lactic acid to assess spore germination and hyphal growth.To evaluate the infectivity of indigenous AM fungal propagules, seeds of   Medicago sativa  were planted in soil samples collected from the experimentalpots. After 6 weeks, plant roots were cleared and stained as described and thepercentage of infected root length was calculated. The collected data weresubmitted to one-way ANOVA.  Analyses of eubacterial communities. (i) First year, microcosm level; DNA extraction from rhizospheres of microcosm-grown plants.  Roots from sandwichmembranes harvested after 35 days were shaken in Ringer’s solution with glassbeads for 30 min; the pellet obtained by centrifugation was used for DNA extraction by cetyltrimethylammonium bromide (CTAB) protocol (2). (ii) First year, greenhouse level; rhizosphere and bulk soil DNA extraction. For the study of the composition of the bacterial communities, rhizosphere andbulk soil were sampled from the same experimental pots after 8 and 10 weeks.Five replicates for each plant line were mixed together, sieved at 2 mm, and thenmaintained at  20°C for molecular analyses. Rhizosphere samples consisted of the roots and the soil tightly adhering to roots.DNA was extracted in triplicate from 500 mg of rhizosphere and bulk soil withthe FastDNA Spin Kit for Soil (BIO 101 Systems Q-BIO Gene, Rome, Italy) inits own beadbeating system (FastPrep FP120; Savant, Rome, Italy), following themanufacturer’s instructions. The three samples were then collected for molecularanalysis. DNA extraction from culturable heterotrophic aerobic fraction of rhizosphereeubacterial community.  A total of 5 g of rhizosphere soil was suspended in 45 mlof sterile water and shaken for 30 min; serial dilutions were plated on 0.1%tryptic soy agar and incubated at 28°C for 5 days. All the colonies from the 10  3 dilution were collected with 2 ml of sterile water and centrifuged, and the pellets were frozen at  20°C. The DNAs were extracted from cumulative pellets by theCTAB method (2). (iii) Second year, greenhouse level.  The samples analyzed were the sameutilized for the studies of   G. mosseae , with the exception that at time zerorhizosphere soil was collected from three replicate plants for each line. Rhizosphere and bulk soil DNA and RNA coextraction.  The simultaneouscoextraction of DNA and RNA from rhizosphere and bulk soil was performedaccording to Griffiths et al. (23), lysing cells by means of the Fast Prep Instru-ment FP 120 (Savant) and the DNA Spin Kit for Soil (BIO 101 Systems Q-BIOgene) lysing matrix; the only modification was a second extraction with half theinitial volume of CTAB extraction buffer and phenol-chloroform-isoamilic alco- TABLE 1. Primers used in this work for 16S rDNA sequencing Primer(  E. coli  position) Sequence 5  –3   Referenceor source P0 (27f)  GAGAGTTTGATCCTGGCTCAG  33P8 (342r)  CTGCTGCCTCCCGTAG  33P4 (561r)  CTTTACGCCCAGTAATT  This workP4A (561f)  AATTACTGGGCGTAAAG  This workP2 (704f)  GTAGCGGTGAAATGCGTAGA  This workP3B (765r)  CTGTTTGCTCCCCACGCTTTC  This workP5 (930f)  AAGGAATTGACGGGGGC  33P6 (1495r)  CTACGGCTACCTTGTTACGA  336720 CASTALDINI ET AL. A  PPL  . E NVIRON . M ICROBIOL  .  hol (25:24:1), pH 8.0. Nucleic acids were extracted from three subsamples fortransgenic and nontransgenic plants and collected together for bulk soil, whilethe rhizospheric soil of three replicate plants for each line was analyzed sepa-rately. Subsequently, half of the final volume of resuspended nucleic acids wastreated with RQ1 RNase-free DNase (Promega, Milano, Italy) or DNase-freeRNase (Roche Diagnostics, Monza, Italy) alternatively, following the manufac-turers’ instructions. DNA was recovered after ethanol precipitation and resus-pended in TE buffer, pH 8 (10 mM Tris-HCl, 0.1 mM EDTA, pH 8), while RNA  was immediately stored at  80°C. DNA extraction from culturable heterotrophic aerobic fraction of bulk soileubacterial community.  Immediately after being sieved, 10 g of soil samples fromthe 4 months’ harvest was suspended in 90 ml of sterile water and shaken for 30min; serial dilutions were plated on 0.1% tryptic soy agar and incubated at 28°Cfor 5 days. Before collecting total aerobic heterotrophic culturable bacteria fromsoil of the second sampling, we randomly isolated nearly 100 colonies for eachline, and all the colonies from the same dilution were collected with sterile waterand centrifuged. The pellets were frozen at   20°C. The DNAs were extractedfrom isolates and cumulative pellets by the CTAB method (2). PCR amplification of 16S rRNA gene fragments for DGGE analysis.  ForDGGE analysis, the V6 to V8 regions of 16S rRNA genes were amplified withprimer pair GC986f and Uni1401r as described by Felske et al. (14). The reactionmixture (50   l) contained 25 ng of DNA, 250   M deoxynucleoside triphos-phates, 1.5 mM MgCl 2 , 1  buffer, and 2.5 U of   Taq  DNA polymerase (Polymed,Florence, Italy). The buffer contained 67 mM Tris-HCl (pH 8.8), 16.6 mM(NH 4 ) 2 SO 4 , 0.01% Tween 20, and 5 mM MgCl 2 . The reaction was performed ina PTC 200 thermocycler with the following thermal protocol: 1 initial cycle of 94°C for 1.5 min, 56°C for 30 s, and 72°C for 45 s. Subsequently, 33 cycles werecarried out, each consisting of 95°C for 20 s, 56°C for 30 s, and 72°C for 45 s,followed by a final extension step at 72°C for 5 min. Each sample was amplifiedthree times, and the amplicons were pooled together before DGGE analysis,according to previous reports (25, 64, 65). Reverse transcription-PCR (RT-PCR) amplification of 16S rRNA fragmentsfor DGGE analysis.  To generate cDNA, 16S rRNA was reverse transcribed withRT enzyme ImProm II (Promega) with primer Uni1401r, following the manu-facturer’s instructions. Then, 5   l of RT reaction mixture was used in a 50-  lamplification reaction mixture under the same conditions described for 16SrRNA gene fragments. DGGE analysis of eubacterial community.  The analysis was performed withthe D-CODE System (Bio-Rad, Milan, Italy) on a 6% polyacrylamide gel (acryl-amide/bis ratio, 37.5:1), under denaturation conditions (urea, 7 M; 40% form-amide with a denaturing gradient ranging from 42 to 58%); the gels were run in1  Tris-acetate-EDTA buffer at 75 V for 16 h at 60°C and were stained with 12 FIG. 1. (A) 16S rRNA gene DGGE profiles (V6-V8 region) of rhizospheric eubacterial microflora associated with Bt and non-Bt cornplants grown in microcosm. (B) Cluster analysis based on UPGMA of DGGE profiles shown in panel A. Scale bar numbers indicate similar-ities among profiles.FIG. 2. 16S rRNA gene DGGE profiles (V6-V8 region) of rhizospheric eubacterial communities associated with Bt and non-Bt corn plantsgrown in pots for 8 (A) and 10 (B) weeks. (C and D) Cluster analyses based on UPGMA of DGGE profiles shown in panels A (C) and B (D).Scale bar numbers indicate similarities among profiles.V OL  . 71, 2005 IMPACT OF Bt CORN ON SOIL MICROBIAL COMMUNITIES 6721  ml of 1  Tris-acetate-EDTA buffer containing 1.2  l of SYBR Green I (dilution,1:10,000) for 30 min in the dark. Visualization and digital pictures were per-formed with a ChemiDoc System (Bio-Rad). Dendrogram construction.  Using fingerprinting pattern of each plot, geneticsimilarities of the populations in the different samples were determined bypairwise comparison of the presence and absence of bands and of the intensityof each band in different samples with Diversity Database Software (Bio-Rad). A matrix containing similarity values was obtained with the Dice coefficient. Thismatrix was used to construct a dendrogram according to the unweighted-pairgroup method, using arithmetic average (UPGMA) cluster analysis. Copheneticcorrelation coefficients were determined to assess the significance of clustersobtained (agreement between similarity values implied by the phenogram andthe srcinal similarity matrix).  Amplified 16S rRNA gene restriction analysis (ARDRA).  Amplification of nearly all the16S rRNA genes was performed directly on DNA of bacterialisolated strain with two universal primers 27f and 1495r (34) under the followingreaction conditions: 25 ng of DNA in a 50-  l reaction mixture containing 250  Meach primer, 250  M deoxynucleoside triphosphates, 1.5 mM MgCl 2 , 1  buffer,and 2.5 U Polytaq (Polymed Biotechnology Division, Florence, Italy). 16S rRNA genes were amplified in a 25-cycle touchdown PCR with 30 s of denaturation at95°C, 30 s of annealing at temperature decreasing five grades from 60°C to 50°Cevery five cycles, 2 min of elongation at 72°C, and a final elongation of 10 min atthe same temperature. An aliquot of each PCR, containing 200 ng of DNA, wasdigested with 10 U of the restriction enzymes AluI and MspI (Roche Diagnos-tics) separately in a total volume of 20  l at 37°C for 3 h. The reaction products were analyzed on a 1   Tris-borate-EDTA agarose gel (2.5% [wt/vol]) with anelectrophoretic run at 150 V-150 mA for 150 min. The combination of profilesobtained by the two digestions allowed isolates to be grouped into operativetaxonomic units (OTUs) (45). Sequencing of 16S rDNAs.  Nearly all 16S rRNA genes from selected OTUs were sequenced with the primers listed in Table 1. Sequencing was carried out atthe the Interdepartmental Centre for Agricultural, Chemical, and IndustrialBiotechnology (CIBIACI) at the University of Florence using the ABI PRISMBigDyeTM Terminator Cycle Sequencing kit, version 1.1 (PE Applied Biosys-tems, Foster City, CA) according to the manufacturer’s recommendations. Theparameters for cycle sequencing in the Primus 96 Plus thermocycler (MWGBiotech) were 18 s of delay at 96°C, followed by 25 cycles, each consisting of 18 sat 96°C, 5 s at 50°C, and 4 min at 60°C. Electrophoresis was performed with an ABI Prism 310 CE system (PE Applied Biosystems).Sequences were entered into the BLAST nucleotide search program of theNational Center for Biotechnology Information to obtain closely related phylo-genetic sequences. The dendrograms displaying phylogenetic positions of theseven sequenced isolates were based on alignments with similar 16S rRNA genesequences, performed with CLUSTAL W software. The phylogenetic tree wasthen generated by the neighbor-joining method with TREECON software andbootstrap values based on 100 replicates (7). FIG. 3. (A) 16S rRNA gene DGGE profiles (V6-V8 region) of culturable rhizospheric bacteria of Bt and non-Bt corn plants grown inpots for 10 weeks. (B) Cluster analysis based on UPGMA of DGGEprofiles shown in panel A. Scale bar numbers indicate similaritiesamong profiles.FIG. 4. (A) 16S rRNA gene and rRNA DGGE profiles (V6-V8region) of rhizospheric eubacterial communities of individual Bt andnon-Bt corn plants after 12 weeks’ growth. (B and C) Cluster analysesbased on UPGMA of DGGE profiles of rRNA genes and rRNA,respectively. Scale bar numbers indicate similarities among profiles.6722 CASTALDINI ET AL. A  PPL  . E NVIRON . M ICROBIOL  .  Soil respiration.  Biochemical analyses were carried out with samples collectedin the first year after 8 and 10 weeks of plant growth and in the second year withsamples collected 2 months after residues were plowed under. Soil was previouslyair-dried, sieved to 2 mm, rewetted to its   33-kPa field water tension, andincubated at 30°C.Soil respiration was measured in a closed system by the method of Isermeyer(30), where NaOH solution was neutralized by CO 2  derived from soil organicmatter oxidation. CO 2  evolution was measured after l, 2, 4, 7, 10, 14, and 17 days. Average values of the CO 2  daily evolution are given in milligrams per CO 2 carbon kg  1 (dry weight) of soil to obtain cumulative respiration curves. Multiplelinear regression was performed to model relationships between CO 2  productionand the different variables (time, treatment, time    treatment) by using SPSSsoftware for Windows, version 12 (SPSS, Inc., Chicago, Ill.). Nucleotide sequence accession numbers.  GenBank accession numbers for theisolates sequences reported in this work are as follows: AY965246, AY965247, AY965248, AY965249, AY965250, AY965251, and AY965252. RESULTS Analyses of eubacterial community.  DGGE analysis of rhi-zospheric eubacteria of seedlings grown in the sandwich systemshowed differences among the communities characterizing thethree corn lines, and Bt plants clustered together after UP-GMA analysis (Fig. 1), although the cophenetic correlation FIG. 5. (A) 16S rRNA gene and rRNA DGGE profiles (V6-V8 region) of soil eubacterial communities after Bt and non-Bt corn residues areplowed under. Arabic and Roman numerals indicate rRNA genes and rRNAs, respectively. (B) Cluster analysis based on UPGMA of DGGEprofiles shown in panel A. Scale bar numbers indicate similarities among profiles.FIG. 6. (A) 16S rRNA gene DGGE profiles (V6-V8 region) of culturable heterotrophic aerobic soil bacteria after Bt and non-Bt corn residues were plowed under. (B) Cluster analysis based on UPGMA of DGGE profiles shown in panel A. Scale bar numbers indicate similarities amongprofiles.V OL  . 71, 2005 IMPACT OF Bt CORN ON SOIL MICROBIAL COMMUNITIES 6723
Advertisement
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks